RegulonDB RegulonDB 10.9: Gene Sequence
ygdG gene sequence


Size: 756        A: 183  T: 174  G: 209  C: 190

Fasta

 

>ygdG E. coli K12. Version NC_000913.3 GI:556503834
gtggctgttcatttgcttattgtcgatgcactgaatcttattcgtcgcattcatgccgtt
caggggtcgccctgtgtcgaaacctgccagcatgcgctcgatcagctcattatgcacagc
cagccaacccacgcggtcgccgtttttgatgatgaaaaccgcagtagcggctggcgtcat
cagcgtttaccagattacaaagcgggtcgaccgccaatgccggaagagttgcacgacgag
atgcctgcattacgcgccgcctttgagcaacgcggcgtcccgtgctggtcaaccagcggc
aacgaagccgatgacttagccgccacgctggcggtcaaagtgacacaggccgggcatcag
gcaacgattgtttcgacagataaaggctactgtcagttactttcaccgacattacgtatt
cgtgattacttccagaaacgttggctggatgcgccatttatcgataaagaatttggcgtt
caaccgcagcagttgcccgattactggggacttgcggggatcagcagttcaaaggtaccg
ggtgttgcgggaatcggaccaaaaagcgccacgcagctgctggtcgagtttcagagtctg
gaagggatatatgagaatctggatgcggttgccgaaaagtggcgcaaaaaattagaaacc
cataaagagatggcgtttctgtgccgcgatattgcccgcttacaaaccgatttgcatatc
gacggcaatttacagcaattgcggttggtacggtaa
              
                            

Download fasta file
RegulonDB