RegulonDB RegulonDB 10.9: Gene Sequence
yhfG gene sequence


Size: 168        A: 42  T: 40  G: 45  C: 41

Fasta

 

>yhfG E. coli K12. Version NC_000913.3 GI:556503834
gtgaagaaactcaccgataagcaaaagtcccgtctctgggagcttcagcgtaatcgtaat
tttcaggccagtcgccgtcttgaaggcgtcgagatgcctttagtcactcttactgccgca
gaggctttagcgcgccttgaagagctgaggagtcactatgagcgataa
              
                            

Download fasta file
RegulonDB