RegulonDB RegulonDB 10.9: Gene Sequence
ycaI gene sequence


Size: 2265        A: 520  T: 624  G: 603  C: 518

Fasta

 

>ycaI E. coli K12. Version NC_000913.3 GI:556503834
atgaaaataacgacagtcggtgtatgcataattagcggaatttttccgttgctgattttg
ccccaattgcctgggacattaacccttgcgtttctgactctcttcgcctgcgtactggca
tttatccctgttaaaaccgtccgttatatcgcgctgacgttgctgtttttcgtttggggc
atattatcagcaaagcaaattttgtgggcaggagaaaccttaactggcgcgacgcaggat
gcaattgttgagatcactgcaactgacggcatgaccactcattacggtcaaattactcat
ctacaaggtcgacgtatattccctgcgtcaggtctcgtgatgtatggcgaatatcttccg
caagcggtttgtgctggacaacaatggtcaatgaaactcaaagttcgtgcagttcatggc
caacttaatgatggcggctttgatagccagcgttatgccattgcccagcatcagccgctc
accggccgttttctgcaggcaagtgtcattgaaccgaattgtagcctgcgtgcacagtat
ctggcgtcactacaaacaacgctgcaaccctatccgtggaatgcggttattcttggttta
ggtatgggggaacggttatccgtccccaaagaaatcaaaaatatcatgcgcgatactgga
acggcgcatttaatggcgatatcgggattgcacatcgcttttgcggcgttgctggctgcc
ggactcattcgcagtggacaaatttttctgcctgggcgctggatccactggcaaatacca
ttaattggcggaatctgctgtgctgctttttatgcctggttgacgggaatgcaacctcct
gcattgcgtaccatggtggcgcttgctacgtggggaatgcttaagttaagtgggcgacag
tggagtggctgggatgtatggatatgttgtctggcggcaattttgctgatggatcctgtt
gccattctctcgcaaagtttatggctctctgccgctgcggtcgcggcattgatattttgg
tatcagtggtttccctgtcctgagtggcaactgccgccggtattgcgtgcagttgtttcc
ctcatccatctgcaactgggaatcacacttctgcttatgcccgtgcaaatcgtcatattt
catggcattagtctgacctcgtttattgcaaatctattagcaattcccttggtgacattt
atcacggttccgttgatcctcgccgcgatggttgtgcatttaagcgggccgttaatcctg
gagcaagggttatggtttcttgccgaccggtctttggctttacttttctgggggttaaag
agtttgccggaagggtggatcaacattgctgaatgttggcaatggctatcattttcccca
tggttcttactggtggtatggcgattaaacgcctggcgaacgttgccagcaatgtgtgtg
gctggaggcttgctgatgtgctggccgctgtggcaaaaacctcgacctgacgagtggcag
ctgtacatgcttgatgtcgggcaagggctggcaatggtgatagccagaaacggcaaagcg
attctctatgacacaggactggcctggcctgaaggggatagtgggcaacaactgattatc
ccctggctccactggcataatcttgaaccggaaggcgttattctgagccatgaacatctg
gatcaccggggagggctggattcaatattgcatatatggccgatgttatggatcagaagt
ccgttaaactgggaacatcatcagccctgtgtgcgtggcgaagcgtggcaatggcaagga
ttgcgtttcagcgcgcactggcctttacaaggtagcaacgataaaggaaataaccattcc
tgtgtggttaaggttgatgacgggacgaatagcattcttctaaccggtgatattgaagcc
ccagctgaacaaaagatgctaagccgttactggcagcaagtgcaggcaacattgcttcag
gtacctcaccatggcagtaatacctcatcatcgttgccattaattcagcgagtgaatgga
aaagtggcactcgcatcggcatcgcgctataacgcatggcgactgccctctaacaaagtt
aagcatcgctatcaactgcaaggatatcaatggattgatactccacatcaaggtcaaaca
acggtcaatttttcagcgcaaggctggcggattagcagcctcagggagcaaattttacct
cgttggtatcatcagtggtttggcgtgccagtggataacgggtag
              
                            

Download fasta file
RegulonDB