RegulonDB RegulonDB 10.9: Gene Sequence
yecD gene sequence


Size: 567        A: 132  T: 134  G: 156  C: 145

Fasta

 

>yecD E. coli K12. Version NC_000913.3 GI:556503834
atgcttgaacttaatgctaaaaccactgcgctggtggtgatcgatttacaagaaggcatc
ttaccttttgccggtggtccacatactgccgatgaggtagttaatcgcgccgggaagctg
gcggcgaaatttcgcgccagcggtcagcccgtgtttctggtgcgcgttggctggtctgcc
gattacgctgaagcattaaaacagccggtcgatgcgccctcaccggctaaagtgttgccc
gaaaattggtggcaacatcctgctgcattaggtgcaaccgacagcgatatcgaaatcatc
aaacgtcaatggggtgcgttttacggtacggatctggagttgcaattacgccgccgaggt
atcgatacaatagtgttatgtgggatctcgaccaatatcggtgttgaatccaccgcccgc
aatgcctgggaacttggctttaatctggtgattgccgaagacgcctgtagtgccgccagc
gccgagcagcacaataacagtatcaaccatatctacccgcgcatcgcccgtgtgcgtagc
gtggaagagatcctcaacgcgttatga
              
                            

Download fasta file
RegulonDB