RegulonDB RegulonDB 10.9: Gene Sequence
yecE gene sequence


Size: 819        A: 193  T: 208  G: 199  C: 219

Fasta

 

>yecE E. coli K12. Version NC_000913.3 GI:556503834
atgatttacatcggtctaccgcaatggtcgcatcctaaatgggtgcggttggggatcacc
agccttgaagagtatgcccgccactttaactgcgtggagggcaacaccacgctttacgcc
ctgccgaaacccgaggttgtcctgcgctggcgtgagcagaccacagatgacttccgcttc
tgttttaagtttccggcgaccatttcgcatcaggcagcattacggcattgcgatgattta
gtgactgaatttttgacccgcatgtcaccgttggctccgcgcattgggcaatactggctg
caactgcctgccacattcggcccacgggagctgcctgcgctttggcattttctcgattct
cttcctggcgaatttaattatggcgtggaagtccgccatccacagtttttcgccaaagga
gaagaggaacaaacgcttaatcgcggtttacatcagcgcggcgttaatcgggtgatttta
gacagccgcccggttcatgcagcacgtccacacagtgaagctattcgcgacgctcaacga
aaaaaacctaaagttccggtacatgctgtactgacggcgacaaatccgctgatccgtttt
atcggtagtgatgatatgacgcaaaaccgggaattatttcaggtctggttacaaaaatta
gcgcagtggcatcagaccactacgccttatctttttttacatacgccagacattgcccag
gcaccggaactggtacataccctgtgggaagacttacgtaaaacgcttccagagatcgga
gcagttccggctattccacagcaatcttctcttttctga
              
                            

Download fasta file
RegulonDB