RegulonDB RegulonDB 10.9: Gene Sequence
rcsD gene sequence


Size: 2673        A: 718  T: 635  G: 676  C: 644

Fasta

 

>rcsD E. coli K12. Version NC_000913.3 GI:556503834
atgcgtcagaaagagacaacggccacgacccgcttttcactcctaccggggagcattacc
cgcttctttttactgttgatcattgtgttactggtgacgatgggtgtaatggtacaaagc
gccgttaacgcctggctgaaagataaaagttaccagattgtcgacattacccatgctatc
caaaagcgcgtcgataactggcgttacgtgacctggcagatctacgacaacattgccgcg
acgacctccccctcctccggcgaaggtttacaagagacgcgcctgaaacaggatgtctac
tatctggagaaaccacgccgcaaaacggaagcgttaatctttggctctcacgacaactca
acgcttgagatgactcagcggatgtccacttatctggatacattgtggggcgcagaaaat
gtaccgtggtcgatgtattacctgaatggtcaggataacagtctggtgctgatctcaacc
ctaccccttaaagatctcacctccggatttaaagaatcgaccgtcagcgacattgttgat
tcacgtcgtgcagagatgttgcaacaggccaacgccctcgatgaacgcgaaagcttttct
aacatgcgccgcctggcctggcagaacggtcattactttacattgcgtactacctttaac
cagccaggacatctggcaacggtcgtggcttttgatctgccgattaatgatttgatccca
ccgggtatgccgctggacagtttccgccttgagccagacgcgacggcaacgggaaacaat
gataatgagaaagaagggacggatagcgtcagtatccactttaacagtacgaagattgaa
atctcctcggcactcaactctaccgatatgcgcctggtctggcaggttccttatggcacc
ttattgctggatacgttgcaaaacattctgctgccactgctgctgaacatcggtttgctg
gcgctggcgttatttggctataccacattccgccatttctccagccgcagtacagaaaac
gtccccagcacggcggtcaataacgaattgcgcattttacgggcaatcaatgaagagata
gtctcactgctgccgctcggcctgctggttcacgatcaggaatcgaaccgcactgtcata
agtaacaaaattgccgatcatttgctgccgcatttgaatctgcaaaacatcaccaccatg
gcggaacagcatcaggggattattcaggcgacgatcaataacgagctgtatgagatccgc
atgttccgcagccaggtcgcgccgcgcacacaaattttcattattcgcgatcaggatcgc
gaagtgctggtaaacaagaaactcaagcaggcgcagcgtctgtatgagaaaaaccagcag
gggcggatgatctttatgaaaaacattggcgatgcgctgaaagaacccgcacagtccctg
gcggagagcgcggctaaactcaacgccccggaaagcaaacaactggcgaatcaggcagat
gtgctggtgcggctggttgatgaaatacagttagcgaacatgcttgcggatgatagctgg
aaaagtgagacggtgctgttctccgtgcaggatttaattgatgaagttgtgccttcagtg
ttgcctgccatcaagcgtaaaggtctgcaactgctgattaacaatcatctgaaagcacac
gatatgcgccgcggcgatcgcgatgccttacgacgtattttgctgctactgatgcaatat
gccgtgacctcaacgcaattgggaaaaatcacccttgaggttgatcaggatgagtcctcc
gaagaccgcctgacgttccgcattctggacacgggagaaggcgtaagtattcatgaaatg
gataatttgcacttcccgtttatcaaccagacccaaaacgatcgctatggcaaggcggac
ccgctggcattctggctgagcgatcaactggcacgtaaactgggcggtcatttaaacatc
aaaacgcgggatgggcttggtacacgctactctgtgcatatcaaaatgctcgcagctgac
ccggaagttgaagaggaagaagagcgtttactggatgatgtctgcgtaatggtggatgtt
acttcggcagaaattcggaatattgtcactcgccagttagaaaattggggtgcaacctgt
atcacacccgatgaaagattaattagtcaagattatgatatctttttaacggataatccg
tctaatcttactgcctctggcttgcttttaagcgatgatgagtctggcgtacgggaaatt
gggcctggtcaattgtgcgtcaacttcaatatgagcaacgctatgcaggaagcggtctta
caattaattgaagtgcaactggcgcaggaagaggtgacagaatcgcctctgggcggagat
gaaaatgcgcaactccatgccagcggctattatgcgctctttgtagacacagtaccggat
gatgttaagaggctgtatactgaagcagcaaccagtgactttgctgcgttagcccaaacg
gctcatcgtcttaaaggcgtatttgccatgctaaatctggtacccggcaagcagttatgt
gaaacgctggaacatctgattcgtgagaaggatgttccaggaatagaaaaatacatcagc
gacattgacagttatgtcaagagcttgctgtag
              
                            

Download fasta file
RegulonDB