RegulonDB RegulonDB 10.9: Gene Sequence
sfmF gene sequence


Size: 516        A: 126  T: 132  G: 139  C: 119

Fasta

 

>sfmF E. coli K12. Version NC_000913.3 GI:556503834
atgagaagagtactctttagctgtttctgcgggctactgtggagttccagtggatgggca
gttgaccctttaggaacgattaatatcaatttgcacggtaacgttgttgatttctcctgt
accgtaaacacagcggatattgataagacggtagatttaggcagatggcctacgacacaa
ctactgaacgctggcgataccacggcactcgtcccttttagcctgcggctggagggatgt
cctccgggttcagttgcgattttatttacgggaacgccggcatccgataccaacctgctg
gctctggatgatcccgcaatggcacaaaccgtcgccatcgaattacgtaatagcgatcgc
tcccggctcgcactgggggaggcgagcccgactgaggaagtagatgcaaatggcaatgtc
acactaaacttttttgccaattatcgagcgttagccagcggtgttcggccaggtgtggcg
aaagcggatgcgatatttatgatcaattataattaa
              
                            

Download fasta file
RegulonDB