RegulonDB RegulonDB 10.9: Gene Sequence
dauA gene sequence


Size: 1680        A: 285  T: 477  G: 486  C: 432

Fasta

 

>dauA E. coli K12. Version NC_000913.3 GI:556503834
gtgaacaaaatattttcctcacatgtgatgcctttccgcgctctgatcgacgcttgctgg
aaagaaaaatatactgccgcacggtttacccgtgacctgattgccgggataaccgtcggg
attattgctatcccgctggcgatggcgttggctattggtagtggtgtggcaccccagtac
ggtttatataccgcagctgttgcggggattgtcattgctctgacgggtgggtcacgcttt
agcgtttccggtccgactgcggcatttgtggtaattctctatcccgtgtcgcaacagttt
ggactggcaggactgctggttgcgaccttgctgtcggggatctttttgattctgatgggt
ctggcacgctttggtcgcctgattgagtatattccggtttccgtcaccttaggtttcacc
tcgggtatcgggatcaccatcggtaccatgcagattaaagattttctcggtctgcaaatg
gcccatgtcccggaacattatctacaaaaagtcggcgcattatttatggcgctgccgacc
attaatgtgggtgatgctgccattggcattgtgacgctaggtattcttgttttttggccg
cgtctgggcattcgtttacccggtcaccttccggccttgctggctggttgcgcggtgatg
gggattgttaacctgctcggcggacatgttgctaccatcggttcgcaattccactacgtc
ctggccgatggttctcagggtaacggtattccgcaactgctgccgcaactggtgctgccg
tgggatctgcctaattcagaattcacgctaacctgggattctattcgcacactgctgcct
gcggcattctcaatggcaatgctcggcgcaatcgaatctctgctctgcgccgtggtgctg
gatggtatgaccgggacgaaacacaaggcgaacagcgaactggttggacagggactgggg
aatattatcgctccgttctttggtggtattaccgctacagctgccatcgcgcgttctgcc
gctaacgtccgtgccggggcaacgtcccctatctcggcggtgatccactctattctggtt
attcttgccctgctggtactggcaccgctgctctcctggctgccgctttccgccatggca
gccctgctgttgatggtggcgtggaacatgagtgaagcgcacaaagtggtcgacttgctg
cgtcatgcgccgaaagatgacatcatcgtcatgctgctgtgcatgtcgctgaccgtgttg
tttgatatggttattgccatcagcgtggggatcgtgctggcatcgctgctgtttatgcgt
cgtatcgcacgtatgactcgcctggcaccggtagtcgtagatgttccagacgatgtcctg
gttctgcgcgttattggcccgctgttttttgctgctgctgaaggcttattcacggacctg
gagtcacgtcttgaaggcaaacggattgtgattctgaagtgggatgccgttccggtactt
gatgctggtggtcttgatgcgttccagcgttttgtgaagcgtctgcccgagggatgtgaa
ctgcgcgtgtgcaacgtggaattccagccactgcgcactatggctcgcgctggcattcaa
ccgatcccgggacgcctggcgttcttcccgaatcgtcgcgcggcgatggcggatttataa
              
                            

Download fasta file
RegulonDB