RegulonDB RegulonDB 10.9: Gene Sequence
ybgE gene sequence


Size: 294        A: 47  T: 101  G: 84  C: 62

Fasta

 

>ybgE E. coli K12. Version NC_000913.3 GI:556503834
atgagtaagattatcgcgactttgtatgcggtaatggacaagcgccccctgcgggcgctt
tccttcgtgatggcgcttctgttagcaggatgtatgttttgggacccatctcgttttgcc
gcgaagaccagtgaactggaaatctggcatggtttattgctgatgtgggccgtctgtgct
ggtgtgattcacggcgtgggctttcgtccgcagaaggttctttggcaagggattttttgc
ccattgcttgccgatattgttctcattgtcgggctgattttcttcttcttttaa
              
                            

Download fasta file
RegulonDB