RegulonDB RegulonDB 10.9: Gene Sequence
dgcE gene sequence


Size: 3318        A: 744  T: 837  G: 906  C: 831

Fasta

 

>dgcE E. coli K12. Version NC_000913.3 GI:556503834
atgagcaaacaatcacagcatgtattaattgccctgccccacccgctgcttcacctggtc
agtttaggtttagtctcgtttatctttacccttttctcgcttgagctttcgcagtttggc
acccaactcgccccactgtggttcccgacgtccatcatgatggtggcgttttatcgccat
gccgggcgcatgtggccgggaattgcgctgagctgttcgctgggaaatatcgccgcatcc
atcctgcttttttccaccagctcgctgaacatgacctggacgaccatcaatattgttgaa
gccgtggtcggggcagtgctgctacgtaaattgctgccgtggtataaccccttgcaaaat
ctggctgactggctgcgtctggcactcggcagcgccattgttccgcctctgttggggggt
gttctggttgtcctgctgacgcccggagacgatcctctcagggcatttttgatatgggta
ctgtcagaatccatcggcgctctggcactggtgccgctgggattgttatttaaaccacac
tatctgctgcgccatcgcaacccacggttgctttttgagtcgctgctcacgttagccatc
acactgacgttaagctggctttcgatgctgtatctgccgtggccttttactttcattatt
gtgctgttgatgtggagcgccgtgcgtctgccacgaatggaagcctttttgatcttcctt
accacggtgatgatggtgtcgctgatgatggccgcggatccctccctgcttgctacgccg
cgtacgtacctgatgagccatatgccgtggctaccgtttttgctgatcctgctgcccgcc
aacatcatgaccatggtgatgtatgcctttcgtgcggaacgcaaacacatttccgaaagc
gaaacccactttcggaacgcgatggaatattccgctatcggtatggcgttagtgggcacc
gagggacaatggctgcaaaccaacaaagcgctctgccagtttctcgggtacagtcaggaa
gagctgcgcggactcacctttcagcaactgacctggccggaggatctcaataaagatctc
caacaggttgaaaagctgataagcggtgaaataaacacctattcaatggaaaaacgctac
tacaaccgcaatggcgatgttgtctgggcgttgcttgccgtctcactggtgcgccacacg
gatggcacgccgctctattttatcgctcagattgaagacattaacgagctaaaacgcacc
gaacaggtcaatcagcaactgatggagcgcatcactctggctaacgaagcgggcgggatt
ggcatctgggagtgggagttgaagccgaatatttttagctgggataagcggatgttcgag
ctgtatgaaattcctccacatatcaaaccgaactggcaggtgtggtacgagtgcgtgctg
ccggaagatcgccagcatgccgaaaaagtgattcgtgattcgttgcaatcacgctcgccc
tttaaactggaatttcgcattaccgtaaaagacggtattcgccatatccgcgccctcgcc
aaccgggtactgaataaagaaggcgaagtcgaacgtctcctcggcatcaatatggatatg
accgaagtgaaacagcttaacgaggcattgtttcaggaaaaagagcgcctgcacattacg
cttgattccatcggtgaagccgtggtctgtattgatatggcgatgaaaattacctttatg
aatccagtggcggagaagatgagcggctggacgcaggaagaagcgttaggtgttccgctc
ctgacggtgttgcatattacttttggcgacaacggaccattaatggagaacatttacagt
gccgacacctcacgttccgcgatcgagcaagatgtggtgttgcactgtcggagcggcggc
agttacgacgtgcattacagtattacgccgttaagtactctggacggcagcaatattggt
tcggttctggtgattcaggacgttaccgaatcacgcaaaatgctgcgccagctgagctac
agcgcctcccatgatgcactgacgcatctcgccaaccgcgccagttttgagaaacaactg
cgtatcctgctgcaaacggtaaacagtacacatcagcgacatgccctggtgtttatcgat
cttgatcgctttaaagcggtgaatgacagcgccgggcatgcggcgggtgacgctttgctg
cgcgaactggcgtcgttaatgctgagtatgctgcgttccagcgacgtgctggcgcgactc
ggtggggatgaatttggtctgctgctaccagactgtaatgttgaaagcgcgcgttttatc
gctacacgcattatcagtgccgtgaatgactatcactttatatgggaaggccgtgtgcat
cgggtaggtgccagtgccgggattaccttgattgatgacaacaatcatcaggcggcagaa
gtgatgtcgcaggctgatatcgcctgttatgcctccaaaaatggtggccggggccgggtg
acggtttacgaaccgcagcaagctgccgcacatagcgaacgggcggcgatgtcgcttgat
gaacagtggcggatgattaaagagaatcagttgatgatgctcgcccacggtgtcgcttcg
ccacggatcccggaagcgcgtaatttgtggctgatttcacttaagctctggagttgcgaa
ggcgagattattgatgaacaaacatttcgtcgtagcttcagcgatccggcgcttagccat
gctcttgaccgccgggtattccacgaatttttccagcaggccgcaaaagcggttgccagt
aaaggcataagcatctccctccccctttccgttgccggtttgagtagcgccacgctggtg
aatgatctgcttgagcagctggaaaatagccctctaccaccacggttattacatctgatt
attccggctgaagcgattttagatcacgcagaaagcgtgcaaaaactgcggctggcggga
tgtcggatagtgctcagccaggtgggccgcgatctgcaaatcttcaactcgctgaaagcg
aatatggcagattacctgctacttgatggtgagttatgcgccaacgtgcagggtaatttg
atggatgagatgctgattacgattattcaggggcacgctcagcgactcgggatgaaaacc
atcgccgggccagtcgttttacccttagtgatggatacgctttctggcatcggcgtcgat
ctgatttatggtgaggtgattgccgatgcccaaccgctggatttgctggtgaatagtagt
tatttcgcgattaactga
              
                            

Download fasta file
RegulonDB