RegulonDB RegulonDB 10.9: Gene Sequence
ycbF gene sequence


Size: 711        A: 179  T: 164  G: 201  C: 167

Fasta

 

>ycbF E. coli K12. Version NC_000913.3 GI:556503834
atgactaatacgtggaacagattggcgctcttgattttcgccgttttatcgctgctggtg
gcgggtgaattgcaggcaggagtggtggtcggcggaacgcgatttatctttccggcagac
agagaatcgatatctattttactgactaataccagtcaggaatcctggcttattaacagt
aaaatcaaccgcccaacgcgttgggccgggggggaagcgtcgacagtgccagcaccatta
ctggccgctccgccacttattctcctgaagcccggtacgacaggcacgttgcgcttgctg
agaacggaaagcgacatcttgcctgtggatcgcgaaacgctatttgagttaagcattgcc
agcgtgccatccggcaaagttgaaaatcagagcgtaaaagtggcgatgcgctcggtattt
aaactgttctggcgacccgaaggtttgccgggcgacccgctggaagcttatcaacaatta
cgctggacacggaattcgcagggtgtacaactcactaacccaacgccttattacattaac
ctgattcaggtgagtgtaaatggtaaagcgttaagtaatgtgggagttgtgccgcctaaa
agccagcgtcagacaagctggtgtcaggcaatcgcaccgtgtcatgtcgcctggcgggcg
ataaatgattacggcgggttgagtgcaaagaaggagcaaaatctgccctga
              
                            

Download fasta file
RegulonDB