RegulonDB RegulonDB 10.9: Gene Sequence
chaB gene sequence


Size: 231        A: 83  T: 43  G: 60  C: 45

Fasta

 

>chaB E. coli K12. Version NC_000913.3 GI:556503834
atgccgtataaaacgaaaagcgatctgccggaaagcgtaaagcacgttctaccgtctcat
gcccaggatatctataaagaagcgttcaacagcgcatgggatcaatataaagataaagaa
gatcggcgtgatgacgccagtcgcgaagaaaccgcgcataaagtggcctgggctgctgtg
aagcatgaatatgccaaaggggatgatgataaatggcataaaaaatcgtaa
              
                            

Download fasta file
RegulonDB