RegulonDB RegulonDB 10.9: Gene Sequence
ychO gene sequence


Size: 1395        A: 360  T: 330  G: 386  C: 319

Fasta

 

>ychO E. coli K12. Version NC_000913.3 GI:556503834
ttgagccgtttcgttcctcgcattatcccgttttatttactcttgcttgtagcaggcggt
acagctaacgcacaatctaccttcgagcaaaaagcggcaaatccctttgataataacaat
gatggtctgccggatttaggcatggctcccgaaaatcatgatggggaaaaacactttgct
gaaattgtgaaagatttcggcgaaaccagtatgaatgataacgggctggatactggcgag
caggcaaaagctttcgcattgggaaaagtccgcgacgcgcttagtcaacaggttaatcag
cacgtagagtcctggctatcaccgtggggaaatgccagtgttgacgtcaaagtggataac
gaaggacatttcaccggcagtcgtggaagctggtttgtgccgttacaagataatgatcgt
tatctcacctggagccagcttggtcttactcagcaggataatgggttggtgagcaatgtg
ggcgttgggcaacgctgggcgcgcggcaactggctggtgggttataacactttttatgac
aacttgctggacgaaaatcttcagcgagcgggctttggtgccgaagcgtggggcgaatat
ttgcgattatcggcaaacttttatcagccgtttgctgcatggcatgaacagacagccacg
caggaacaacggatggcgcgcgggtacgacctgacagctcggatgcgcatgccgttctat
caacacctcaataccagtgtcagcctagaacagtattttggtgatcgtgttgatttgttt
aactctggtacgggttatcacaatcccgtcgcgttgagtctgggattaaattacacccct
gtgccattagtcactgtgacggcccagcataaacagggtgaaagtggcgaaaatcaaaat
aacctcgggctgaatcttaattaccgctttggtgtaccgctcaaaaaacaactttctgcg
ggcgaggttgccgaaagtcagtcgttacgtggtagtcgctatgacaatccgcagcgaaat
aatctaccgactcttgagtaccgacagcgaaaaacgttaacggtgtttctggcgacaccg
ccgtgggatctaaaacctggcgaaacagtgccgctgaaattacaaatccgcagtcgttac
ggtattcggcaactgatttggcagggcgatacgcagatattaagtttgacgccgggcgca
caagccaacagcgcggagggctggacgctgatcatgcctgactggcagaacggggaaggg
gcaagcaatcactggcgattgtctgtggtggtggaagataaccaggggcagcgtgtctcc
tccaatgagatcacgctaacgcttgtcgaaccgttcgatgcattgtcaaacgacgaactg
cgctgggaaccgtaa
              
                            

Download fasta file
RegulonDB