RegulonDB RegulonDB 11.0: Gene Sequence
cecR gene sequence


Size: 672        A: 164  T: 144  G: 169  C: 195

Fasta

 

>cecR E. coli K12. Version NC_000913.3 GI:556503834
atgaataatcctgccatgacaatcaagggtgaacaggcgaaaaaacagctgattgctgcc
gcactggcgcagtttggtgaatatggaatgaacgccaccactcgcgagatagccgcccag
gccgggcagaatatcgctgccatcacctactacttcggttcgaaagaagatttgtacctc
gcctgcgcccagtggattgccgattttattggcgagcagttccgtccgcatgccgaggaa
gccgaacgcttgttcgcgcaaccacagcctgatcgggctgccatccgtgaactgatcctt
cgcgcctgcaggaacatgattaagctgctcacccaggatgacaccgtcaacctcagcaag
tttatctcccgtgagcagctctctcccacggcagcctaccacctggtgcacgaacaggtg
attagtccgctacacagccacctgacacgcctgattgccgcctggaccggctgcgacgcc
aatgacacccgcatgatccttcatacccatgcgttgattggtgagattctggcgttccgt
cttggcaaagaaacaattctgttacgtaccggctggaccgcgttcgatgaagaaaagacc
gaactgatcaaccagacggtgacctgtcatatcgacctgattttgcaaggattatcgcaa
aggagtttgtag
              
                            

Download fasta file
RegulonDB