RegulonDB RegulonDB 10.9: Gene Sequence
iaaA gene sequence


Size: 966        A: 218  T: 202  G: 313  C: 233

Fasta

 

>iaaA E. coli K12. Version NC_000913.3 GI:556503834
atgggcaaagcagtcattgcaattcatggtggcgcaggtgcaattagccgcgcgcagatg
agtctgcaacaggaattacgctacatcgaggcgttgtctgccattgttgaaaccgggcag
aaaatgctggaagcgggcgaaagtgcgctggatgtggtgacggaagcggtgcgtctgctg
gaagagtgtccactgtttaacgccggaattggcgctgtctttacgcgtgatgaaacccat
gaactggacgcctgtgtgatggatggtaacaccctgaaagccggtgcggtggcgggcgtt
agtcatctgcgtaatccggttcttgccgcccggctggtgatggagcaaagcccgcatgtg
atgatgattggcgaaggggcagaaaattttgcgtttgctcgtggcatggagcgcgtctcg
ccggagattttctccacgtctttgcgttatgaacaactactggcagcgcgcaaggaaggg
gcaaccgtcctcgaccatagcggtgcgccactggatgaaaaacagaaaatgggcaccgtg
ggggccgtggcgttggatttagacggcaatttggcggcagccacgtccacaggcggaatg
accaataaattacccggacgagttggcgatagtcccttagtgggtgccggatgctacgcc
aataacgccagtgtggcggtttcttgtaccggcacgggcgaagtcttcatccgcgcgctg
gcggcatatgacatcgccgcgttaatggattacggcggattaagtctcgcggaagcctgc
gagcgggtagtaatggaaaaactccctgcgcttggcggtagcggtggcttaatcgctatc
gaccatgaagggaatgtcgcgctaccgtttaacaccgaaggaatgtatcgcgcctggggc
tacgcaggcgatacgccaaccaccggtatctaccgtgaaaaaggggacaccgttgccaca
cagtga
              
                            

Download fasta file
RegulonDB