RegulonDB RegulonDB 10.9: Gene Sequence
aegA gene sequence


Size: 1980        A: 452  T: 425  G: 585  C: 518

Fasta

 

>aegA E. coli K12. Version NC_000913.3 GI:556503834
atgaatcgttttattatggccaacagtcagcaatgtctgggttgtcatgcttgtgaaatc
gcctgtgtcatggctcacaatgatgagcaacatgtcctgagccaacaccattttcatccc
cgaattacggttatcaaacatcaacagcaacgtagtgcagtgacctgtcaccattgtgaa
gatgcgccctgcgcccgtagctgccctaatggcgcaatcagccacgttgatgacagcatt
caggtcaatcagcaaaagtgtattggctgtaaatcctgcgtggtggcctgtccttttggt
acgatgcaaatcgtcctgacacccgtcgcggcaggaaaagtaaaagccacggcgcataaa
tgcgacctttgtgcggggcgcgaaaacggtcctgcctgtgttgagaattgcccggcggac
gcgctgcaactggtcactgacgtcgcactctccggcatggcgaaatcccgccgcttgcgc
accgcgcgtcaggaacatcaaccgtggcatgccagtaccgcggcgcaagaaatgccggta
atgagtaaagtcgaacaaatgcaggcaacgcccgcgcgtggcgagccggataaactggcg
attgaagcgcgcaaaaccggttttgatgaaatttatctgccatttcgcgccgaccaggca
caacgggaagcctcgcgctgccttaagtgcggcgagcacagcgtttgtgaatggacctgc
ccgctgcataaccatataccgcagtggattgaactggtgaaagccggaaacatcgacgcc
gccgtcgagctttctcaccagaccaacaccctgccggaaattaccggacgcgtttgtccg
caagaccgtttgtgtgaaggtgcctgtactattcgcgatgagcacggcgcggtaactatc
ggcaacattgaacgctacatttcagatcaggcgttggcgaaaggttggcgtcctgactta
agccatgtcaccaaagtggacaagcgggtggcgattatcggtgcaggtccggcagggctg
gcctgtgcggatgttctgacccgcaatggcgtgggggtgacggtgtacgatcgccatcca
gaaatcggtggcttgctcactttcggcattccttctttcaaactggataaatccctgctg
gcacgccgtcgggaaatcttcagcgcgatggggattcacttcgaactcaattgtgaagtg
ggtaaagatgtctctttggattcgcttttggaacaatacgacgcggtcttcgttggcgta
ggcacttaccgttccatgaaagcgggtttacccaatgaagatgcgccgggcgtttatgac
gcgctgccgttcctcattgccaacactaaacaggtgatggggctcgaagagctaccggaa
gagccgtttatcaataccgccggacttaacgtcgtggtactgggcggcggcgacaccgcg
atggactgtgtgcgtaccgcactgcgccacggcgcgagtaacgtcacctgcgcttatcgt
cgtgatgaagctaacatgccaggctcgaagaaagaagtgaagaacgcccgcgaagagggg
gccaacttcgaatttaacgtccagccggtggcgcttgagctgaatgaacaaggtcacgtc
tgcgggattcgtttcctgcgcacgcgtcttggagagccggatgcccaggggcgtcggcgt
ccagtgccggtggaaggcagtgaatttgtcatgccagccgacgcggtgattatggcgttt
ggcttcaatccgcacgggatgccgtggctggagtcgcacggtgtaacggtagacaaatgg
ggccgcatcatcgcggatgtggaaagccagtaccgttaccagaccaccaatccgaaaatc
ttcgctggtggtgacgccgtgcgtggtgcggatctggtggttaccgcaatggcagaagga
cgtcatgcggcacaggggattattgactggctgggggtaaaatcagtcaaatctcactga
              
                            

Download fasta file
RegulonDB