RegulonDB RegulonDB 10.9: Gene Sequence
nudK gene sequence


Size: 576        A: 164  T: 132  G: 152  C: 128

Fasta

 

>nudK E. coli K12. Version NC_000913.3 GI:556503834
atgacgcaacaaatcaccctcattaaagacaaaattctctccgataactatttcaccctg
cacaacattacttacgatctcacgcgcaaagacggcgaagttatccgccataaacgtgaa
gtgtacgatcgcggcaatggtgcgacgatcctcctgtacaacacgaagaaaaagaccgtg
gttctgattcgtcagttccgtgtcgctacctgggttaatggcaatgaaagcgggcagctg
attgaaagctgcgccgggctgctggataacgacgaaccggaagtgtgtattcgcaaagaa
gcgattgaagagacgggctatgaagtgggtgaagtgcgcaaattatttgaactgtatatg
tcgccaggcggtgtgactgagctaatccacttttttatcgccgaatacagtgacaatcag
cgcgctaacgccggtggcggtgtcgaagatgaagatattgaagtgctcgagctgccgttc
agccaggcgctggagatgatcaaaaccggcgagatacgtgacggtaagacggtgttattg
cttaactatttgcaaacgtcacatttaatggactga
              
                            

Download fasta file
RegulonDB