RegulonDB RegulonDB 10.9: Gene Sequence
gatA gene sequence


Size: 453        A: 130  T: 130  G: 101  C: 92

Fasta

 

>gatA E. coli K12. Version NC_000913.3 GI:556503834
atgactaacctgtttgttcgtagcggaatttcttttgtcgatcgtagcgaagttttaacc
catatcggtaatgagatgctcgccaaaggtgtggttcatgatacctggccacaggcatta
attgccagagaagcagaattccctaccgggataatgcttgagcagcacgctattgcaata
ccgcattgtgaggcgattcatgctaagtcgtcagccatttatctgttaaggccaacaaat
aaagttcattttcagcaagcggatgatgataacgacgtggcggtatcgttggttattgcg
ttgattgtggaaaatccgcagcagcaattgaaacttttacgctgtttatttggcaagtta
caacagcccgatatcgtcgagacactaatcactcttcctgaaacccagttaaaggaatac
ttcacaaagtatgttttagattcagacgaataa
              
                            

Download fasta file
RegulonDB