RegulonDB RegulonDB 10.9: Gene Sequence
gatB gene sequence


Size: 285        A: 80  T: 86  G: 71  C: 48

Fasta

 

>gatB E. coli K12. Version NC_000913.3 GI:556503834
atgaaacgcaagattattgtcgcttgcggaggcgcggttgcgacctctacgatggcggcg
gaagaaattaaagagttgtgtcagaatcataatattcctgttgaattaatccagtgtcgg
gttaatgaaatagaaacctatatggatggtgtgcatttgatatgcaccactgccaaagtg
gatcgtagttttggcgatattccgttagttcacggcatgccttttatttctggtatcggt
atcgaagcattacaaaataaaattctgactatcttacaggggtga
              
                            

Download fasta file
RegulonDB