RegulonDB RegulonDB 10.9: Gene Sequence
gatY gene sequence


Size: 855        A: 209  T: 192  G: 240  C: 214

Fasta

 

>gatY E. coli K12. Version NC_000913.3 GI:556503834
atgtacgtggtatcgacaaagcagatgctgaacaacgcacagcgcggcggttatgcggtt
ccggcattcaatattcacaatctcgaaacgatgcaagtggtggtagaaaccgctgccaac
ctgcatgcgccggtcatcatcgccggaacgcctggcacatttactcatgctggtacagaa
aatctgttggcgctggtcagcgcgatggcgaagcaatatcaccatccactggcaattcat
ctcgaccatcacacgaaatttgacgatatcgctcagaaggttcgttctggcgtgcgctca
gtcatgattgacgcctcgcatttgccttttgcgcaaaatatttcacgggtcaaagaggtg
gtggatttttgccatcgctttgatgtcagcgtcgaggcggagctggggcaacttggcggc
caggaagatgatgtgcaagtcaatgaagccgatgcgttgtacaccaaccccgctcaggcg
cgtgaatttgccgaggcaaccggaattgattccctggcggtcgccatcggcacggctcat
gggatgtatgccagcgcaccggcgcttgatttttctagactggagaacattcgccagtgg
gtgaacttaccgctggtgctgcatggcgcgtcagggttatcgactaaggatattcagcaa
accatcaaactggggatatgcaaaatcaacgttgcaacggagctgaaaaatgccttctcg
caggcgttaaaaaattacctgaccgagcaccctgaagcgaccgatccccgggattatttg
cagtcggctaaatccgcaatgcgcgatgtggtgagcaaagtgattgccgattgtggctgc
gagggcagggcataa
              
                            

Download fasta file
RegulonDB