RegulonDB RegulonDB 10.9: Gene Sequence
ybiJ gene sequence


Size: 261        A: 70  T: 59  G: 65  C: 67

Fasta

 

>ybiJ E. coli K12. Version NC_000913.3 GI:556503834
atgaaaactatcaatactgttgttgctgctatggctctttcaactctgtcatttggcgtg
ttcgcggcggaaccggtaacggcatcccaggcacagaacatgaataaaatcggcgtggtt
tctgccgatggcgcatccaccctcgatgccctggaagcgaaactggctgagaaagccgcg
gcagccggtgccagtggatacagcatcacttccgccaccaacaacaataaattaagcggt
actgcggtaatttataagtaa
              
                            

Download fasta file
RegulonDB