RegulonDB RegulonDB 10.9: Gene Sequence
tauD gene sequence


Size: 852        A: 198  T: 190  G: 242  C: 222

Fasta

 

>tauD E. coli K12. Version NC_000913.3 GI:556503834
atgagtgaacgtctgagcattaccccgctggggccgtatatcggcgcacaaatttcgggt
gccgacctgacgcgcccgttaagcgataatcagtttgaacagctttaccatgcggtgctg
cgccatcaggtggtgtttctacgcgatcaagctattacgccgcagcagcaacgcgcgctg
gcccagcgttttggcgaattgcatattcaccctgtttacccgcatgccgaaggggttgac
gagatcatcgtgctggatacccataacgataatccgccagataacgacaactggcatacc
gatgtgacatttattgaaacgccacccgcaggggcgattctggcagctaaagagttacct
tcgaccggcggtgatacgctctggaccagcggtattgcggcctatgaggcgctctctgtt
cccttccgccagctgctgagtgggctgcgtgcggagcatgatttccgtaaatcgttcccg
gaatacaaataccgcaaaaccgaggaggaacatcaacgctggcgcgaggcggtcgcgaaa
aacccgccgttgctacatccggtggtgcgaacgcatccggtgagcggtaaacaggcgctg
tttgtgaatgaaggctttactacgcgaattgttgatgtgagcgagaaagagagcgaagcc
ttgttaagttttttgtttgcccatatcaccaaaccggagtttcaggtgcgctggcgctgg
caaccaaatgatattgcgatttgggataaccgcgtgacccagcactatgccaatgccgat
tacctgccacagcgacggataatgcatcgggcgacgatccttggggataaaccgttttat
cgggcggggtaa
              
                            

Download fasta file
RegulonDB