RegulonDB RegulonDB 11.0: Gene Sequence
modA gene sequence


Size: 774        A: 198  T: 182  G: 216  C: 178

Fasta

 

>modA E. coli K12. Version NC_000913.3 GI:556503834
atggctcgtaaatggttgaacttgtttgccggggcggcactctctttcgctgttgctggc
aatgcactggcagatgaagggaaaatcacggtgttcgccgccgcatcactgactaacgca
atgcaggacattgctacgcagtttaaaaaagagaaaggcgtggatgtggtttcttctttc
gcttcgtcatctactctcgcccgtcagattgaagcgggtgcgcctgcggatctgtttatt
tctgccgatcagaaatggatggattatgcggttgataaaaaagcgatcgatacagctacg
cgtcagacactgctcggcaatagcctggtcgttgtagcaccgaaagccagcgtgcagaaa
gatttcaccatcgacagcaaaaccaactggacttcactgctgaatggcggtcgcctggcg
gttggcgatccggaacatgttcccgctggcatttatgcaaaagaagcactgcaaaaactg
ggcgcatgggatacgctctctccgaaactggccccagcggaagatgttcgtggggcgctg
gcgctggtcgaacgtaacgaagcgcctctgggcattgtctacggttctgacgcagttgcc
agcaaaggggtaaaagtggttgccaccttcccggaagattcacataaaaaagtggaatat
ccggttgctgttgtggaagggcataacaatgcgacagtgaaagcattttatgattatctg
aagggaccgcaggcagcggaaatctttaaacgttacggatttacaatcaagtaa
              
                            

Download fasta file
RegulonDB