RegulonDB RegulonDB 10.9: Gene Sequence
ydiF gene sequence


Size: 1596        A: 427  T: 411  G: 404  C: 354

Fasta

 

>ydiF E. coli K12. Version NC_000913.3 GI:556503834
atgaaacctgtaaaaccacctcgtattaatggacgagtgccggtcctgtcggcacaggaa
gcggtgaattatattcccgacgaagcaacactttgtgtgttaggcgctggcggcggtatt
ctggaagccaccacgttaattactgctcttgctgataaatataaacagactcaaacacca
cgtaatttatcgattattagtccaacagggcttggcgatcgcgccgaccgtggtattagt
cctctggcgcaagaaggtctggtgaaatgggcattatgtggtcactggggacaatcgccg
cgtatttctgaactcgcagaacaaaataaaattattgcttataactacccacaaggtgta
cttacacaaaccttacgcgccgccgcagcccaccagcctggtattattagtgatattggc
atcgggacatttgtcgatccacgccagcaaggcggcaaactgaatgaagtcactaaagaa
gacctgattaaactggtcgagtttgataacaaagaatatctctattacaaagcgattgcg
ccagatattgccttcattcgcgctaccacctgcgacagtgaaggctacgccacttttgaa
gatgaggtgatgtatctcgacgcattggttattgcccaggcggtgcacaataacggcggt
attgtgatgatgcaggtgcagaaaatggttaagaaagccacgctgcatcctaaatctgtc
cgtattccgggttatctggtggatattgtggtggtcgatccggatcaaacccaactgtat
ggcggtgcaccggttaaccgctttatttctggtgacttcacccttgatgacagtaccaaa
cttagcctgcccctaaaccaacgtaaattagttgcgcggcgcgcattattcgaaatgcgt
aaaggcgcggtggggaatgtcggcgtcggtattgctgacggcattggcctggtcgcccga
gaagaaggttgtgctgatgactttattctgacggtagaaacaggtccgattggcggaatt
acttcacaggggatcgcctttggcgcgaacgtgaatacccgtgccattctggatatgacg
tcccagtttgatttttatcacggtggcggtctggatgtttgttatttgagttttgctgaa
gtcgaccagcacggtaacgtcggcgtgcataaattcaatggtaaaatcatgggcaccggt
ggatttattgatatcagtgccacttcgaagaaaatcattttctgcggcacattaactgcg
ggcagtttaaaaacagaaattaccgacggcaaattaaatatcgtccaggaaggacgggtg
aagaaatttattcgggaactaccggaaattactttcagcggaaaaatcgctctcgagcga
gggctggatgttcgttatatcactgagcgcgcagtattcacgctgaaagaagacggcctg
catttaatcgaaatcgcccctggcgtcgatttacaaaaagatattctcgacaaaatggat
ttcaccccagtgatttcgccagaactcaaactgatggacgaaagattatttatcgatgcg
gcgatgggttttgtcctgcctgaagcggctcattaa
              
                            

Download fasta file
RegulonDB