RegulonDB RegulonDB 10.10: Gene Sequence
rluB gene sequence


Size: 876        A: 201  T: 204  G: 266  C: 205

Fasta

 

>rluB E. coli K12. Version NC_000913.3 GI:556503834
atgagcgaaaagctacagaaagtgctggcgcgtgccggccacggttctcgccgtgaaatc
gaatctattattgaagccggtcgtgtgagtgttgatggcaaaattgctaaactcggcgat
cgtgttgaagttacccctggattgaaaatccgtatcgatggtcacctgatttcggtacgt
gagtccgctgaacaaatttgtcgcgttctggcctattacaaaccggaaggtgagttgtgt
acccgtaacgatccggaaggacgtccaacggtgtttgaccgtctgccaaaactgcgtggc
gcacgctggattgccgtgggtcgcttggacgttaatacctgtggtctgctgctgttcacc
accgatggtgaactggcaaaccgtttaatgcacccaagccgtgaagttgaacgtgaatat
gccgtgcgtgtatttggtcaggttgacgacgcgaaactgcgtgatttgagtcgtggcgtg
cagttggaagatggtccggcagcttttaaaaccatcaagttcagcggcggcgaagggatc
aaccagtggtacaacgtgactctgaccgaaggccgtaaccgtgaagttcgtcgtctgtgg
gaagcggttggtgtgcaggtgagccgcctgatccgtgttcgttacggtgatatcccactg
ccaaaaggtctgccacgcggtggctggacggagctggacctcgcccagactaactatctg
cgcgaactggtggagctaccgccagaaaccagctctaaagtcgctgtagaaaaagaccgt
cgtcgcatgaaggcgaatcagattcgtcgtgcggtgaaacgtcacagtcaggtgagcggc
ggtcgtcgttctggcggacgtaataataacggttaa
              
                            

Download fasta file
RegulonDB