RegulonDB RegulonDB 10.9: Gene Sequence
yfjD gene sequence


Size: 1287        A: 312  T: 317  G: 349  C: 309

Fasta

 

>yfjD E. coli K12. Version NC_000913.3 GI:556503834
ctggaacacatttctactactacgttgatcattattctgatcatcatggtggtcatttca
gcctatttttccgggtccgaaaccggaatgatgaccctcaaccgctatcgtctgcgacat
atggcgaaacagggtaatcgctcggccaaacgcgtcgaaaaattgctgcgtaagccagac
cgcctgataagcctggtgttaatcggcaataacctggtcaatattcttgcctccgcgctc
ggcactattgttgggatgcgtttgtacggcgatgcgggcgtggcaattgcgactggtgtg
ctgacttttgtcgtactggtatttgctgaggtattgccgaaaaccattgccgcgctgtac
ccggaaaaagtcgcttatccgagtagttttctgctggctccgctgcaaattttgatgatg
ccgctggtctggttgctgaatgctatcacccgtatgctgatgcgcatgatgggtatcaaa
accgatatcgtggttagcggctctttgagcaaagaagagttgcgcactatcgtgcacgaa
tcacgctcacaaatttcccgtcgcaatcaggatatgctgctgtcggtgctcgatctggaa
aaaatgaccgttgatgacatcatggtgccgcgcagtgaaattatcggtattgatatcaac
gatgactggaaatcgattctgcgccaactctcccactcacctcacgggcgcatcgtgctc
taccgtgattcgctggacgacgccatcagtatgctgcgagtacgtgaagcctggcggttg
atgtcggagaaaaaagagttcaccaaagaaaccatgctgcgcgccgcggacgagatctat
tttgtgccggaaggtacgccgctcagcacgcagttggtaaagtttcagcgcaacaaaaag
aaagtcggcctggtcgtcaacgagtatggagacattcaggggctggtgacggttgaagat
attctggaagagattgtcggcgatttcactacgtcgatgtcgccaacacttgccgaagag
gtcacgccgcaaaacgacggttcggtgattatcgatggcaccgccaacgtgcgggaaatc
aacaaagcctttaactggcatctaccggaagatgatgcccgcacggttaatggcgtcatt
cttgaggcactggaagagatccctgtcgcaggcacccgcgtgcgtattggcgagtacgat
atcgatattctcgacgtacaggacaatatgattaagcaggtaaaagtttttcctgtgaaa
ccgctgcgcgagagtgtggcggagtaa
              
                            

Download fasta file
RegulonDB