RegulonDB RegulonDB 10.9: Gene Sequence
ycfJ gene sequence


Size: 540        A: 134  T: 116  G: 169  C: 121

Fasta

 

>ycfJ E. coli K12. Version NC_000913.3 GI:556503834
gtgaataaatcaatgttggcgggtatcgggattggtgtcgcagctgcgctgggcgtagcg
gcagtggccagtctgaacgtgtttgaacggggcccgcaatacgctcaggttgtttctgca
accccaatcaaggaaacggttaaaacaccgcgtcaggagtgtcgcaacgtcacagtgacc
catcgtcgaccggtgcaggatgaaaatcgcattaccgggtcggtgctcggcgctgttgct
ggcggcgtgatagggcatcagtttggtggtggtcgcggtaaagatgtcgccactgttgtg
ggggcgctgggtggtggatatgccggtaaccagatccagggctctctccaggaaagcgat
acttacacgactacgcaacagcgttgtaaaacggtgtatgacaagtcagaaaaaatgctc
ggttatgatgtgacctataagattggcgatcagcagggcaaaatccgcatggaccgcgat
ccgggtacgcagatcccgctagatagcaacgggcaactgattttgaataacaaagtataa
              
                            

Download fasta file
RegulonDB