RegulonDB RegulonDB 10.9: Gene Sequence
yfiL gene sequence


Size: 366        A: 112  T: 87  G: 87  C: 80

Fasta

 

>yfiL E. coli K12. Version NC_000913.3 GI:556503834
atgatgaaaaagtttatcgcccccttgttggctttactggttagcggatgtcagattgat
ccttatactcacgcgccaaccttgaccagcaccgactggtatgatgtcggtatggaagat
gcgatatcgggcagcgccataaaagatgacgatgcatttagcgattcacaggcggatcgc
ggtctataccttaaaggatatgccgaaggacaaaagaaaacttgccagaccgattttact
tatgcccgaggactttccggtaaaagctttcctgccagctgcaacaatgttgaaaatgcc
agccaactgcatgaagtatggcaaaaaggggctgatgaaaatgccagcacaatacgatta
aattaa
              
                            

Download fasta file
RegulonDB