RegulonDB RegulonDB 10.9: Gene Sequence
ybcH gene sequence


Size: 891        A: 208  T: 217  G: 230  C: 236

Fasta

 

>ybcH E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaagttcattttcgtattgctgacactgcttttggtcagccctttttcctttgcg
atgaaaggtattatctggcaaccacaaaaccgagatagtcaggttaccgatacccagtgg
caggggctgatgagtcagttacgtttgcaaggcttcgatacccttgttttgcaatggacc
cgttacggcgatgcatttacccagccagaacagcgcacgttattgtttaagcgggccgca
gctgcgcaacaggctggtctgaagcttattgtcgggctgaacgccgatccggaatttttt
atgcaccagaaacagtcgtccgcagcgctggaaagctatcttaatcgcctgctggctgcc
gatctccagcaagccagattatggagcgccgcgcctggcataacgccggatggctggtac
atcagcgcggaaattgacgacctgaactggcgcagcgaagccgcccgtcagcctttgcta
acatggttaaacaacgcgcagcggctgattagcgatgtttcagcaaaaccggtttatatc
agtagttttttcgccggaaacatgtcgcccgatggctatcgccaactgctggaacacgtt
aaagcaaccggcgttaatgtctgggtacaggatggcagcggcgtggataaactgaccgct
gaacagcgtgaacgttatttacaggccagcgccgattgccaaagtcccgcccctgccagc
ggcgttgtttatgaactttttgtcgccggcaaaggcaaaacctttacagcgaaaccgaaa
ccggacgcagaaattgcctcgctgttagcgaaacgttcctcttgcggtaaagacactctc
tatttctctctgcgctatttgcccgtcgcgcacggcattctcgagtattaa
              
                            

Download fasta file
RegulonDB