RegulonDB RegulonDB 10.9: Gene Sequence
norW gene sequence


Size: 1134        A: 273  T: 248  G: 327  C: 286

Fasta

 

>norW E. coli K12. Version NC_000913.3 GI:556503834
atgagtaacggcattgtgatcatcggttcgggcttcgccgcccgccaactggtgaaaaat
attcgcaaacaggacgccactattccattaaccctgattgccgccgacagcatggatgag
tacaacaaacctgacctcagccatgttatcagtcaggggcaacgtgccgatgaccttacc
cgccagacggcgggtgaatttgccgagcagtttaatctgcacctgtttccacaaacctgg
gtgacggatatcgatgccgaagcccgtgtggtgaaaagccagaataatcagtggcaatac
gacaagctagtactggcaaccggtgccagtgcctttgtcccgcctgtgcctgggcgtgag
ttaatgctgacgttaaatagtcagcaagagtatcgcgcctgtgaaacgcaactgcgggat
gcccgacgcgtgttgattgttggcggtggtttgattggtagcgaactggcgatggatttt
tgtcgtgcaggcaaagcggtcacgctaatcgacaacgctgccagtattctggcgtcgtta
atgccaccggaagtaagcagccgcttgcagcatcggttgacggagatgggcgttcatctg
ctgttgaaatctcagttacaggggctggaaaaaacggattctggcattcaggcaacgctg
gaccgccagcgcaatatcgaagtggatgcggtaattgccgccaccggactgcgcccggaa
accgccctggcacgacgcgccgggctgacgattaatcgcggcgtttgcgtcgatagttat
ctgcaaaccagtaataccgatatttacgcgctgggcgattgcgcggaaattaacggtcag
gtattgccgttcctccagccgattcaacttagcgcgatggtgctggcaaaaaatcttctc
ggcaataacacgccgctgaaactcccggcgatgctggtgaaaatcaaaacgccggaatta
ccgctgcatctggcaggcgaaacccagcgtcaggatttacgctggcaaattaataccgaa
cgccagggaatggtggcgcgcggcgttgacgatgctgaccagcttcgcgcctttgtggtc
agtgaggatcggatgaaagaggcatttggattgttgaaaacattgccgatgtag
              
                            

Download fasta file
RegulonDB