RegulonDB RegulonDB 10.9: Gene Sequence
ybaK gene sequence


Size: 480        A: 134  T: 102  G: 128  C: 116

Fasta

 

>ybaK E. coli K12. Version NC_000913.3 GI:556503834
atgacacccgcagttaaattactcgaaaaaaacaagatttcgtttcaaatccatacctac
gagcacgatccggctgaaaccaattttggcgatgaagtcgtcaaaaaattaggtttgaat
ccggatcaggtctacaaaacgctgctggtggcagtgaacggtgatatgaaacaccttgcc
gtggccgttacgccggtcgcaggtcaactggatcttaaaaaagtagcaaaagcgctgggt
gccaagaaagttgagatggccgatccgatggtcgcgcagcgttcgacgggatacctggtt
ggggggattagcccactggggcagaaaaaacgtctgccaacgattatcgacgcccccgca
caagaatttgccactatttatgtttccggcggcaagcgcggactggatatcgaactggcg
gcaggcgatctggcaaagatcctcgatgccaaatttgctgatatcgcccgccgcgattaa
              
                            

Download fasta file
RegulonDB