RegulonDB RegulonDB 10.9: Gene Sequence
lplT gene sequence


Size: 1194        A: 211  T: 320  G: 375  C: 288

Fasta

 

>lplT E. coli K12. Version NC_000913.3 GI:556503834
atgagtgagtcagtgcacactaacacttcgttgtggtcgaaggggatgaaagcggttatc
gtggcgcagtttctctctgcgtttggcgataatgccctactgtttgccactctggcgtta
ctgaaagcgcagttctatccggagtggagccagcccatcctgcaaatggtgtttgtaggt
gcttacattctttttgcgccgtttgtcgggcaggtggcggatagcttcgccaaaggccgg
gtgatgatgtttgccaacggcctgaagctgctgggcgcagccagtatctgctttggtatc
aatccgtttctcggctatacgctggtgggtgttggtgctgcagcctattcaccggcgaaa
tacggtattctcggcgaattaaccacgggtagtaagttagtgaaagctaacggtttaatg
gaagcttctaccatagcggcgattttgctcggttccgtagccggtggtgtgctggctgac
tggcatgtcctcgtcgccctggccgcatgcgcactggcctacggtggtgcggtcgttgcc
aatatctacattcccaaactggcggcggcgcgtccggggcagtcctggaatctcatcaac
atgacccgcagtttcctgaatgcctgcacctcgctatggcgcaatggtgaaacgcgtttt
tcgctggtgggcaccagtttattctggggagcgggtgtcacgctgcgtttcctgttggtg
ctgtgggtaccggtggcgctgggcattaccgataacgctacgcccacctatctcaacgcg
atggtagcgattggtatcgtggttggcgcaggtgcggcagcgaagttagttacgctggaa
accgtgtcacgctgtatgccagccgggattttgattggcgtggtggtactgattttttcc
ctgcaacacgagctgctgccagcctatgccttgttgatgctgattggcgtgatggggggc
ttttttgtcgttccgctcaatgcgttgctacaggagcggggtaaaaaaagcgtcggggcg
gggaatgcgattgcagtacaaaaccttggcgaaaacagcgccatgttgttgatgctgggc
atttactcgctggcggtaatgataggcatcccggtcgtgcccattggcattggcttcggt
gcgctgtttgcgctggcaataacggcgctgtggatctggcagcgccgtcattaa
              
                            

Download fasta file
RegulonDB