RegulonDB RegulonDB 10.10: Gene Sequence
adiC gene sequence


Size: 1338        A: 249  T: 370  G: 366  C: 353

Fasta

 

>adiC E. coli K12. Version NC_000913.3 GI:556503834
atgtcttcggatgctgatgctcacaaagtgggcttaatccccgtcaccctgatggtgtcg
gggaatattatggggtcaggtgtttttctgttacctgcaaacctggcctctactggcggg
attgccatttatggatggttggtgacgattatcggtgcactggggctctcgatggtatac
gccaaaatgtcgttcctcgacccaagtcctggtggttcttacgcttacgcccgccgctgc
tttggcccgtttctcggttatcaaaccaacgtcctctactggctggcctgctggatcggc
aatatcgccatggtggtcattggcgtaggatatttaagttacttcttcccgattctgaaa
gatccattggtattaaccatcacctgcgtcgtggtgctgtggatcttcgtcctgctgaac
attgtcggtccgaaaatgatcacccgtgtgcaggcagttgccaccgtgctggcgctgatc
cccatcgtcgggattgccgtatttggctggttctggttccgtggtgaaacctatatggcg
gcatggaacgtcagcggcctgggcaccttcggtgcaattcaaagtacccttaacgttacg
ctgtggtcgttcatcggtgtggaaagtgcctccgttgccgcaggtgtggtgaaaaacccg
aaacgcaatgtccctatcgccaccattggtggggtattgattgccgccgtttgctatgta
ctttctaccaccgcgattatggggatgatccctaatgccgcactgcgcgtttctgcttcg
ccattcggtgatgccgcacggatggcgttgggtgacaccgccggggccattgtttccttc
tgcgcagctgcgggttgcttaggttcactgggcggctggacgttgctggcgggtcaaacg
gcgaaagccgctgccgatgacggactgttcccaccgatttttgcccgtgtaaataaagcg
ggtacgccagtggcggggctgattatcgtcggtattttgatgaccatcttccagctcagc
agcatttcaccaaacgcgaccaaagagttcggtctggtttcttccgtctcggtcatcttt
acactggtgccatatctttacacctgtgcggcgttactgctgctcggacacggtcacttt
ggtaaagcacgcccggcatatctggcagttactaccattgccttcctctactgcatctgg
gccgtggtggggtccggagcgaaagaggttatgtggtcatttgtcaccctgatggtcatc
accgccatgtatgcgctgaattacaaccggctacataaaaacccgtatcccttagatgca
ccaataagcaaagattaa
              
                            

Download fasta file
RegulonDB