RegulonDB RegulonDB 10.9: Gene Sequence
yjjX gene sequence


Size: 513        A: 103  T: 122  G: 160  C: 128

Fasta

 

>yjjX E. coli K12. Version NC_000913.3 GI:556503834
atgcaccaagttgtctgtgcgaccaccaatcccgctaaaattcaggccattctgcaggca
tttcacgagatcttcggcgaaggatcctgccatattgcatccgttgccgtcgagagcggt
gtaccggaacagccctttggcagtgaggaaacgcgcgctggcgcacgaaatcgggtagcc
aatgcccgccgtttacttccagaggctgatttttgggtggcgattgaagctggcatcgat
ggtgacagcactttcagttgggtggtgattgaaaacgccagccagcgcggcgaggcgcgt
tcggctactttgccgttgcctgcggtgattctggaaaaagtgcgtgaaggtgaggcgctt
ggtcccgtgatgtcgcgttataccggtattgatgagattggtcgtaaggaaggggcgatc
ggcgtgtttaccgccgggaaactcactcgcgccagcgtctatcaccaggcggtgatcctg
gcgctgagtccgtttcataatgccgtgtattaa
              
                            

Download fasta file
RegulonDB