RegulonDB RegulonDB 10.9: Gene Sequence
fabF gene sequence


Size: 1242        A: 285  T: 295  G: 359  C: 303

Fasta

 

>fabF E. coli K12. Version NC_000913.3 GI:556503834
gtgtctaagcgtcgtgtagttgtgaccggactgggcatgttgtctcctgtcggcaatacc
gtagagtctacctggaaagctctgcttgccggtcagagtggcatcagcctaatcgaccat
ttcgatactagcgcctatgcaacgaaatttgctggcttagtaaaggattttaactgtgag
gacattatctcgcgcaaagaacagcgcaagatggatgccttcattcaatatggaattgtc
gctggcgttcaggccatgcaggattctggccttgaaataacggaagagaacgcaacccgc
attggtgccgcaattggctccgggattggcggcctcggactgatcgaagaaaaccacaca
tctctgatgaacggtggtccacgtaagatcagcccattcttcgttccgtcaacgattgtg
aacatggtggcaggtcatctgactatcatgtatggcctgcgtggcccgagcatctctatc
gcgactgcctgtacttccggcgtgcacaacattggccatgctgcgcgtattatcgcgtat
ggcgatgctgacgtgatggttgcaggtggcgcagagaaagccagtacgccgctgggcgtt
ggtggttttggcgcggcacgtgcattatctacccgcaatgataacccgcaagcggcgagc
cgcccgtgggataaagagcgtgatggtttcgtactgggcgatggtgccggtatgctggta
cttgaagagtacgaacacgcgaaaaaacgcggtgcgaaaatttacgctgaactcgtcggc
tttggtatgagcagcgatgcttatcatatgacgtcaccgccagaaaatggcgcaggcgca
gctctggcgatggcaaatgctctgcgtgatgcaggcattgaagcgagtcagattggctac
gttaacgcgcacggtacttctacgccggctggcgataaagctgaagcgcaggcggtgaaa
accatcttcggtgaagctgcaagccgtgtgttggtaagctccacgaaatctatgaccggt
cacctgttaggtgcggcgggtgcagtagaatctatctactccatcctggcgctgcgcgat
caggctgttccgccaaccatcaacctggataacccggatgaaggttgcgatctggatttc
gtaccgcacgaagcgcgtcaggttagcggaatggaatacactctgtgtaactccttcggc
ttcggtggcactaatggttctttgatctttaaaaagatctaa
              
                            

Download fasta file
RegulonDB