RegulonDB RegulonDB 10.9: Gene Sequence
caiE gene sequence


Size: 591        A: 126  T: 140  G: 190  C: 135

Fasta

 

>caiE E. coli K12. Version NC_000913.3 GI:556503834
gtgagctattacgcctttgaggggttaattccggtggttcacccgacggcgtttgtccat
cccagtgccgtcttgattggcgatgtgattgtgggagccggtgtctacatcggcccactc
gcctcactgcgtggtgactacgggcggttgatcgtgcaagcgggagccaatattcaggat
ggctgcattatgcatggctactgcgacactgacactatcgttggggaaaacggccatatc
gggcacggagcgatcctgcatggttgtttgattggtcgcgatgcattggtcgggatgaac
agcgtgattatggatggcgcggtcattggcgaagagagcattgttgccgccatgagcttt
gtcaaagcgggctttcgcggcgagaaacgccagttgttgatgggtacgccagcccgcgct
gtacgcaatgttagtgacgacgagttacactggaaacggttgaataccaaagagtatcag
gatcttgtcgggcgctgtcatgtatcgttacatgaaacgcagccactgaggcaaatggag
gaaaatcgcccccgtttgcaggggacgacggatgtgacgcctaaacggtga
              
                            

Download fasta file
RegulonDB