RegulonDB RegulonDB 10.9: Gene Sequence
yabP gene sequence


Size: 651        A: 195  T: 162  G: 167  C: 127

Fasta

 

>yabP E. coli K12. Version NC_000913.3 GI:556503834
atgaaagtatcagttccaggcatgccggttacacttttaaatatgagcaagaacgatatt
tataagatggtgagcggggacaagatggacgtgaagatgaatatctttcaacgcttgtgg
gagacgttacgccatctgttctggtcagataaacagactgaggcttataaacttctgttc
aatttcgtgaataaccagactggcaacatcaacgcctcagaatactttactggggctatc
aacgagaatgagagagaaaagtttatcaatagcctggaattattcaataaacttaaaaca
tgcgcaaaaaatccggatgagttggtcgcaaagggcaatatgcgctgggtcgcccagacc
ttcggggatatcgagttaagtgtcacttttttcattgaaaagaataagatatgtactcag
acgttgcagctgcataagggccaaggtaacttgggcgttgatcttagaaaggcttacctt
cccggcgttgacatgagggattgttaccttggtaaaaaaacaatgaaaggtagcaatgat
atcctttatgagagacctgggtggaatgctaacctgggcgtgctaccccggacggtgcta
ccccggacggtgctaacccggacggtgctaacctggacggtgctaccgtga
              
                            

Download fasta file
RegulonDB