RegulonDB RegulonDB 10.9: Gene Sequence
yabQ gene sequence


Size: 159        A: 63  T: 42  G: 27  C: 27

Fasta

 

>yabQ E. coli K12. Version NC_000913.3 GI:556503834
gtgaacggtgctacctccttatatgatgaggtaattattattaataaaatcccccccaaa
aaaattgatactaaaggagttgctactgaagaagttgctactaaaaaagtactgctgaac
aaattactgacaacgcaattattgaatgagccagaataa
              
                            

Download fasta file
RegulonDB