RegulonDB RegulonDB 10.10: Gene Sequence
gntK gene sequence


Size: 528        A: 139  T: 127  G: 140  C: 122

Fasta

 

>gntK E. coli K12. Version NC_000913.3 GI:556503834
ttgagcacgactaaccatgatcaccacatttacgtcttgatgggcgtatcgggcagcggc
aaatctgcggtcgccagtgaagtggcgcatcaacttcatgccgcgtttcttgatggcgat
ttcctccatccacggcgcaatatcgaaaaaatggcgtctggcgaaccactgaatgacgac
gatcgcaaaccgtggttgcaggcgctgaacgacgccgcgtttgctatgcagcgcactaat
aaagtgtcgctgatcgtctgttctgcattgaaaaaacactatcgcgacttgctgcgtgaa
ggtaatccgaatctctctttcatctatttgaaaggcgattttgatgtgattgaaagccgc
ctgaaagcgcgcaaaggccatttctttaaaacccaaatgttggtgacgcagtttgaaacg
ctgcaggagccgggtgcggacgaaaccgatgtactggtggtggatatcgatcaaccgctg
gaaggtgttgtggcaagcaccattgaggttattaaaaaaggcaaataa
              
                            

Download fasta file
RegulonDB