RegulonDB RegulonDB 10.10: Gene Sequence
gntR gene sequence


Size: 996        A: 221  T: 233  G: 280  C: 262

Fasta

 

>gntR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaagaaaagacccgtacttcaggatgtggctgaccgtgtaggcgtgaccaaaatg
acggtcagccgttttttacgcaacccggagcaggtttccgtcgctctacgcggcaagatt
gccgcggctcttgatgaactgggctatattcccaatcgtgcgcccgatatcctctctaac
gccaccagccgggcgattggcgtcctgttaccttctctcaccaaccaggttttcgcggaa
gtattacgcggaatcgaaagcgtcaccgacgcgcacggttatcagaccatgctggcgcac
tacggttataaaccggaaatggagcaagaacgcctcgaatccatgctctcctggaatatc
gacggcctgatcctcaccgaacgtacccacacgccgcgcaccttaaagatgattgaagtg
gcgggtattcccgtggtggaactgatggacagcaagtcgccatgccttgatatcgccgtc
ggttttgataactttgaagcagcacgccagatgaccactgccattattgctcgcgggcat
cgccacattgcctatctcggcgcacgtctcgacgaacgtactatcatcaaacagaaggga
tacgaacaggcgatgctggatgcaggcctggtgccatatagcgtgatggttgagcaatct
tcttcttactcttccggtattgaactgattcgccaggcgcggcgggaatatccgcagctg
gatggcgtgttctgtacgaatgatgacctggcggtcggcgcggcgtttgaatgtcagcgt
ctggggttaaaagttcctgacgatatggcgattgccggtttccacggtcatgacattggt
caggtgatggagccacgacttgcgagcgtgctgacgccgcgtgagcggatgggcagtatt
ggcgctgaacgcctgctggcgcgtattcgtggcgaatctgtgacaccgaaaatgttagat
ttaggtttcaccttgtcaccgggcggatctatttaa
              
                            

Download fasta file
RegulonDB