RegulonDB RegulonDB 10.9: Gene Sequence
nudF gene sequence


Size: 630        A: 164  T: 146  G: 187  C: 133

Fasta

 

>nudF E. coli K12. Version NC_000913.3 GI:556503834
atgcttaagccagacaacctgcccgttacatttggcaaaaacgatgtagaaattattgca
cgagaaacactttatcgcggctttttttcattagatctttatagatttcgtcatcgtcta
ttcaacgggcaaatgagtcatgaggtgcggcgggaaatttttgagcgcggtcacgccgca
gtcttgctaccctttgacccagtgcgtgatgaagttgtgctgattgagcagattcggatt
gccgcgtacgacaccagcgaaaccccttggctactggagatggttgccgggatgattgaa
gagggtgaaagtgtggaagatgttgcccgtcgcgaagcgattgaagaggcgggactgata
gtcaaacggaccaaaccggtgttaagtttcctggcaagcccggggggcaccagtgagcgt
tcgtcaattatggtgggcgaagtggacgccacgaccgcaagcggtattcacggtctggct
gatgaaaacgaagatattcgcgttcatgtggtaagccgggaacaggcataccagtgggta
gaagaggggaaaatcgacaacgcagcgtcggtcatcgctttgcaatggctgcagctgcat
catcaagcgttaaaaaatgagtgggcataa
              
                            

Download fasta file
RegulonDB