RegulonDB RegulonDB 10.10: Gene Sequence
ygiN gene sequence


Size: 315        A: 82  T: 74  G: 86  C: 73

Fasta

 

>ygiN E. coli K12. Version NC_000913.3 GI:556503834
atgcttaccgtaatcgcagaaatccgtactcgtcctggtcaacatcaccgtcaggcggta
ttggatcagtttgctaaaatcgttccaaccgtactgaaagaagaaggttgccacggctat
gcgccaatggtggattgcgcagctggcgtgagtttccagtctatggcaccggattctatc
gtgatgattgagcagtgggaaagcatcgcgcatcttgaagcgcatctgcaaaccccgcac
atgaaggcgtatagcgaagccgtaaaaggtgacgtgctggagatgaatatccgtattctg
cagccagggatttaa
              
                            

Download fasta file
RegulonDB