RegulonDB RegulonDB 10.8: Gene Sequence
gltK gene sequence


Size: 675        A: 124  T: 212  G: 185  C: 154

Fasta

 

>gltK E. coli K12. Version NC_000913.3 GI:556503834
atgtacgagtttgactggagttccattgtcccttccctgccatatctgctcgacgggctg
gtgatcaccctgaaaatcaccgtcacggcggtagtgattggtattttgtggggcacgatg
ctggcggtgatgcgtttatccagctttgcgcccgtggcgtggtttgccaaagcctacgtt
aacgtattccgctcgattcctttagttatggttttgctgtggttttacctgatcgtgccg
ggttttctgcaaaacgtgctgggattatcgccaaaaaatgatatccgtttaatttcggcg
atggtggcgttttcgatgtttgaagcggcctactattcagagattatccgtgctggtatt
caaagtatttctcgtggtcaatcgagcgccgcgctggcgttgggaatgactcactggcag
tcgatgaaactgattattctgccgcaggcgttccgcgcgatggtgccgctgctgctcact
cagggcatcgtactgttccaggatacctcactggtgtatgtgttatccctggccgatttc
ttccgtaccgcctcaaccattggtgagcgtgatggtacgcaggttgagatgatcctgttt
gccggatttgtttatttcgttattagtcttagcgcgtcgttgttggtcagctacttgaaa
agaaggacagcataa
              
                            

Download fasta file
RegulonDB