RegulonDB RegulonDB 10.9: Gene Sequence
yceK gene sequence


Size: 228        A: 43  T: 70  G: 63  C: 52

Fasta

 

>yceK E. coli K12. Version NC_000913.3 GI:556503834
atgcgtttaattgtggtgagcatcatggtgaccttgctgagtggctgtggcagcattatt
agtcgcactataccggggcaggggcatggcaaccaatattatcccggtgtgcaatgggat
gtgcgtgactccgcctggcgttatgtcacgatccttgatctgccattctctctggttttt
gatactttactgctgccgatcgacattcatcatggcccgtatgagtga
              
                            

Download fasta file
RegulonDB