RegulonDB RegulonDB 10.9: Gene Sequence
lapB gene sequence


Size: 1170        A: 297  T: 266  G: 327  C: 280

Fasta

 

>lapB E. coli K12. Version NC_000913.3 GI:556503834
atgctggagttgttgtttctgcttttgcctgtagccgctgcctatggctggtatatgggc
cgcagaagtgcgcaacaaaacaagcaagatgaagccaaccgcttgtcgcgtgattacgta
gcgggggttaacttcctgcttagtaatcaacaggataaagcggtagacctgtttctcgat
atgcttaaagaggatacaggcaccgttgaagcccaccttacgctcggaaacctgttccgt
tcgcgtggcgaagttgatcgcgctattcgcatccatcagaccctaatggaaagcgcctcg
ctgacctatgaacagcgtctgttggcgattcaacaactggggcgtgattacatggccgcc
gggttatatgaccgcgcggaagacatgttcaatcagctgaccgatgaaactgacttccgc
attggcgcgctgcaacagttgctacaaatctaccaggctaccagtgagtggcagaaagca
attgatgttgccgaacgcctggtgaagctgggtaaagataaacagcgcgtcgaaattgcc
catttctactgtgagttagccctgcagcatatggccagcgacgatctcgatcgtgccatg
accttgctaaaaaaaggggcggcggcagataaaaacagcgcccgcgtatccataatgatg
ggacgcgtgtttatggcgaaaggagaatacgccaaagccgtcgaaagtctgcaacgcgtg
atatcccaggacagagaactggtcagcgaaacgctggaaatgttgcaaacctgctatcag
cagttgggtaaaactgccgaatgggcagaattcctgcagcgtgcggtggaagagaacacc
ggtgccgatgctgaattgatgcttgctgatatcatcgaagcgcgcgacggtagtgaggcc
gcacaggtctatattacgcgccagcttcagcgtcatccgaccatgcgtgtgttccataag
ttaatggattaccacttaaatgaagcggaagaagggcgtgccaaagagagcctgatggtg
ctgcgtgacatggttggcgagaaggtacgtagtaagcctcgttatcgttgccagaaatgt
ggttttaccgcatacaccctctactggcattgtccgtcttgtcgggcctggtcaaccatt
aaaccgattcgcggtcttgatggcctgtaa
              
                            

Download fasta file
RegulonDB