RegulonDB RegulonDB 10.9: Gene Sequence
hcxA gene sequence


Size: 1089        A: 236  T: 252  G: 311  C: 290

Fasta

 

>hcxA E. coli K12. Version NC_000913.3 GI:556503834
atgcctcacaatcctatccgcgtggtcgtcggcccggctaactacttttcacatccagga
agtttcaatcacctgcacgattttttcactgatgaacaactttctcgcgcggtgtggatc
tacggcaaacgcgccattgctgcggcgcaaaccaaacttccgccagcgtttggactgcca
ggggcaaagcatattttgtttcgcggtcattgcagcgaaagcgatgtacaacaactggcg
gctgagtccggtgacgaccgcagcgtggtgattggcgtcggtggcggtgcactgctcgac
accgcgaaagccctcgcccgccgtctcggtctgccgtttgttgccgttccgacgatcgcc
gccacctgcgccgcctggacaccgctctccgtctggtataatgatgccggacaggcgctg
cattatgagattttcgacgacgccaattttatggtgctggtggaaccggagattatcctc
aatgcaccgcaacaatatctgctggcggggatcggtgacacgctggcgaaatggtatgaa
gcggtggtgctggctccgcaaccagaaacgttgccgctaaccgtgcgactggggatcaat
aatgcgcaagccattcgcgacgtcttgttaaacagtagcgaacaggcgctgagcgatcag
caaaatcaacagttaacgcaatcattttgcgatgtggtggatgctattattgctggtggt
gggatggttggtggtctgggcgatcgttttacgcgtgtggcggcagctcatgccgtgcat
aacggtctgaccgtgctgccgcaaaccgagaagtttctccacggcaccaaagtcgcctac
ggaattctggtgcaaagcgccttgctgggtcaggatgatgtgctggcgcaattaactgga
gcgtatcagcgttttcatctgccgactacactggcggagctggaagtggatatcaataat
caggcggagatcgacaaagtgattgcccacaccctgcgtccggtggagtccattcattac
ctgccagtcacgctgacaccagatacgttgcgtgcagcgttcaaaaaagtggaatcgttt
aaagcctga
              
                            

Download fasta file
RegulonDB