RegulonDB RegulonDB 10.9: Gene Sequence
ybcI gene sequence


Size: 522        A: 80  T: 165  G: 157  C: 120

Fasta

 

>ybcI E. coli K12. Version NC_000913.3 GI:556503834
atgccaaccgttattacgcacgccgccgttcccctatgcattggtttagggttgggttcg
aaagtcatccctccgcgtctgttatttgccggaatcatcctggcgatgctgcccgacgcc
gacgtattgtcgtttaaatttggcgttgcttacggcaatgtttttggtcatcgcgggttt
acccattcgctggtgtttgcgtttgttgtcccgctgttatgtgtgtttattggacgccga
tggttcagggctgggctgattcgctgctggctgtttttaaccgtctcgttgctatcgcac
agcttgctggattcggtaaccactggcggtaaaggcgttggctggctgtggccgtggtca
gatgaacgctttttcgctccctggcaggtgataaaagtcgcgccgtttgcattgtctcgt
tacaccacgccgtacgggcatcaggtgattatttctgaattgatgtgggtgtggttgccg
gggatgctactgatgggaatgttgtggtggcgcagacgataa
              
                            

Download fasta file
RegulonDB