RegulonDB RegulonDB 10.9: Gene Sequence
luxS gene sequence


Size: 516        A: 137  T: 113  G: 145  C: 121

Fasta

 

>luxS E. coli K12. Version NC_000913.3 GI:556503834
atgccgttgttagatagcttcacagtcgatcatacccggatggaagcgcctgcagttcgg
gtggcgaaaacaatgaacaccccgcatggcgacgcaatcaccgtgttcgatctgcgcttc
tgcgtgccgaacaaagaagtgatgccagaaagagggatccataccctggagcacctgttt
gctggttttatgcgtaaccatcttaacggtaatggtgtagagattatcgatatctcgcca
atgggctgccgcaccggtttttatatgagtctgattggtacgccagatgagcagcgtgtt
gctgatgcctggaaagcggcaatggaagacgtgctgaaagtgcaggatcagaatcagatc
ccggaactgaacgtctaccagtgtggcacttaccagatgcactcgttgcaggaagcgcag
gatattgcgcgtagcattctggaacgtgacgtacgcatcaacagcaacgaagaactggca
ctgccgaaagagaagttgcaggaactgcacatctag
              
                            

Download fasta file
RegulonDB