RegulonDB RegulonDB 10.9: Gene Sequence
yddG gene sequence


Size: 882        A: 182  T: 262  G: 232  C: 206

Fasta

 

>yddG E. coli K12. Version NC_000913.3 GI:556503834
atgacacgacaaaaagcaacgctcatagggctgatagcgatcgtcctgtggagcacgatg
gtaggattgattcgcggtgtcagtgaggggctcggcccggtcggcggcgcagctgctatc
tattcattaagcgggctgctgttaatcttcacggttggatttccgcgtattcggcaaatc
ccgaaaggctatttactcgccgggagtctgttattcgtcagctatgaaatctgtctggcg
ctttccttagggtatgcggcgacccatcatcaggcgattgaagtgggtatggtgaactat
ctgtggcccagcctgacaattctctttgccattctgtttaatggtcagaaaaccaactgg
ttgattgtacctggattattattagccctcgtcggcgtctgttgggtgttaggcggtgac
aatgggttacattatgatgaaatcatcaataatatcaccaccagcccattgagttatttc
ctggcgttcattggtgcgtttatctgggcagcctattgcacagtaacgaataaatacgca
cgcggatttaatggaattaccgtttttgtcctgctaacgggagcaagtctgtgggtttac
tattttcttacgccacaaccagaaatgatatttagcacgcccgtcatgattaaactcatc
tctgcggcatttaccttaggatttgcttatgctgcatggaatgtcggtatattgcatggc
aatgtcaccattatggcggtaggttcgtattttacgcctgtactttcctcagcgcttgca
gccgtgctgctcagcgccccgctgtcgttctcgttctggcaaggcgcgctgatggtctgc
ggcggttccctgctctgctggctggcgacacgtcgtggttaa
              
                            

Download fasta file
RegulonDB