RegulonDB RegulonDB 10.9: Gene Sequence
exuR gene sequence


Size: 777        A: 214  T: 170  G: 196  C: 197

Fasta

 

>exuR E. coli K12. Version NC_000913.3 GI:556503834
atggaaatcactgaaccacgccgtttgtatcaacaacttgccgctgacctgaaagagcgc
atcgaacagggcgtctatctggtgggtgataaactgcctgcagaacgctttattgccgat
gaaaagaacgtcagccgtacggtagttcgtgaagccatcatcatgctggaagttgaaggc
tatgtcgaagtgcgtaaaggttcaggtattcatgtggtttccaaccagccgcgccatcag
caggcggctgacaataatatggaattcgccaattacggtccgtttgagttgcttcaggct
cgccagctcatcgaaagtaatattgccgaattcgcggcaactcaggtaacgaaacaggac
atcatgaaactgatggccattcaggaacaggcgcgcggcgaacaatgcttccgtgattcc
gagtgggatttgcagttccacattcaggtcgctctggcgacgcagaactccgccctggcg
gctatcgtggaaaaaatgtggacccagcgtagtcataacccgtactggaaaaaactgcac
gaacacattgattcccgtaccgtcgataactggtgtgatgaccacgatcaaatcctcaag
gcgctgattcgcaaagatcctcatgctgctaagctggcaatgtggcagcatctggaaaac
accaagatcatgttatttaacgaaaccagcgacgacttcgagttcaatgccgaccgctat
ctattcgccgaaaacccggtggtgcatctcgatacagccaccagcggcagtaaatga
              
                            

Download fasta file
RegulonDB